Sequence ID | >WENV180044071 |
Genome ID | LQAJ01001425 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 628 |
End posion on genome | 700 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
catctctaac |
tRNA gene sequence |
GGGGATGTAGCTTAGTTGGGAGAGCGCCGCCTTTGCAAGGCGGAGGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
gctgggctca |
Secondary structure (Cloverleaf model) | >WENV180044071 Ala TGC c Atat gctgggctca G - C G - C G + T G - C A - T T - A G - C T G T T A C C C A T G A A + | | | | G T T T C G G T G G G C G + | | | T T G G A G C G A G AGGTC C - G C - G G - C C - G C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |