Sequence ID | >WENV180044077 |
Genome ID | LQAJ01001852 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 75 |
End posion on genome | 1 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ccaccaatcc |
tRNA gene sequence |
GTCCCCATCGTCTAGTGGCCTAGGACTCCGGCCTCTCACGCCGGCAACAGGGGTTCAAAC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV180044077 Glu CTC c GCCn nnnnnnnnnn G - C T - A C - G C - G C - G C - G A - T C A T T C C C C A T G A C | | | | | A G T C T G A G G G G C G + | | | T T C G G A C C T A T CAAC C - G C - G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |