Sequence ID | >WENV180044108 |
Genome ID | LQAJ01004953 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 596 |
End posion on genome | 522 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ccacccgaac |
tRNA gene sequence |
GGGCGATTAACTCAGCGGGAGAGTGCTACCTTCACACGGTAGAAGTCACTGGTTCAAACC |
Downstream region at tRNA end position |
caatgaaatc |
Secondary structure (Cloverleaf model) | >WENV180044108 Val CAC c ACCA caatgaaatc G - C G - C G - C C - G G - C A - T T - A C A T T G A C C A G A A | | | | | A C C T C A A C T G G C G | | | | T T G G A G T G A G AAGTC C - G T - A A - T C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |