Sequence ID | >WENV180044111 |
Genome ID | LQAJ01005076 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 332 |
End posion on genome | 404 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tgggactagt |
tRNA gene sequence |
GCGGGTGTCGCCAAGTGGTAAGGCATCAGCCTTCCAAGCTGATATTCGCCGGTTCGAATC |
Downstream region at tRNA end position |
ttttttattt |
Secondary structure (Cloverleaf model) | >WENV180044111 Gly TCC t TCtt ttttttattt G - C C - G G - C G - C G - C T + G G - C T A T T G G C C A G A C + | | | | G T A C C G G C C G G C G | | | T T G A G G C T A A TATTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |