Sequence ID | >WENV180044135 |
Genome ID | LQAJ01006682 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 866 |
End posion on genome | 791 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cataagggat |
tRNA gene sequence |
GGGGGTGTAGCTCAGCTGGGAGAGCACCTGCTTTGCACGCAGGGGGTCATGGGTTCGATT |
Downstream region at tRNA end position |
aaatggagac |
Secondary structure (Cloverleaf model) | >WENV180044135 Ala TGC t ACCA aaatggagac G - C G - C G + T G - C G - C T - A G - C T T T T T C C C A C G A A | | | | G T C T C G A T G G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G T C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |