Sequence ID | >WENV180044139 |
Genome ID | LQAJ01007037 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 791 |
End posion on genome | 863 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cgctttctca |
tRNA gene sequence |
GGGTGCTTAGCTCAGCTGGGAGAGCATCGCCCTTACAAGGCGAGGGTCGCAGGTTCGATC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV180044139 Val TAC a Annn nnnnnnnnnn G - C G - C G - C T - A G - C C - G T - A C T T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C G A A GGGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |