Sequence ID | >WENV180044190 |
Genome ID | LQAJ01018650 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 413 |
End posion on genome | 487 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
gtcccgaaat |
tRNA gene sequence |
GGGCGCGTAGCTCAGCTGGTTAGAGCGCACGGTTCACATCCGTGAGGTCGATGGTTCGAG |
Downstream region at tRNA end position |
tttaannnnn |
Secondary structure (Cloverleaf model) | >WENV180044190 Val CAC t ACtt tttaannnnn G - C G - C G - C C - G G - C C - G G - C T G T T T A C C A C G A A + | | | | G T C T C G G A T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C G - C T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |