Sequence ID | >WENV180044198 |
Genome ID | LQAJ01020732 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 356 |
End posion on genome | 431 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
atccacacga |
tRNA gene sequence |
CGCGAGGTGGAGCAGTTGGCAGCTCGTCGGGCTCATAACCCGGAGGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
aattgtctta |
Secondary structure (Cloverleaf model) | >WENV180044198 fMet CAT a ACCA aattgtctta C A G - C C - G G - C A - T G - C G - C T A T T G T C C A T G A G + | | | | G T C G A G G C A G G C G | | | | T T G G C T C C A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |