Sequence ID | >WENV180044207 |
Genome ID | LQAJ01022401 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 346 |
End posion on genome | 271 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
agaaatatat |
tRNA gene sequence |
GGGCCGTTAGCTCAGTTGGTAGAGCAGTGGACTTTTAATCCATTTGTCGAAGGTTCGAAT |
Downstream region at tRNA end position |
caaagagcat |
Secondary structure (Cloverleaf model) | >WENV180044207 Lys TTT t ACCA caaagagcat G - C G - C G - C C - G C - G G + T T - A T A T C T T C C A T G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A TTGTC G + T T - A G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |