| Sequence ID | >WENV180063939 |
| Genome ID | MPLX02383951 |
| Phylum/Class | [MPLX] marine metagenome; 120 m water sample filtered on 0.2 um supor filter |
| Species | |
| Start position on genome | 2310 |
| End posion on genome | 2395 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
ttcagtccgT |
| tRNA gene sequence |
GCCCATCTGGCGGAATTGGTAGACGCGCTGGTTTTAGGTACCAGTGGCTTAGGTCGTGGG |
| Downstream region at tRNA end position |
ttttttaagc |
| Secondary structure (Cloverleaf model) | >WENV180063939 Leu TAG
T ATCC ttttttaagc
G - C
C - G
C - G
C - G
A - T
T + G
C - G T G
T C C C C C A
T A A G | | | | | A
T G G C G G G G G G C
G | | | T T
G A C G C
T A G G TGGCTTAGGTCGT
C - G
T - A
G - C
G - C
T - A
T T
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |