Sequence ID | >WENV180094296 |
Genome ID | MTBK01000231 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 795 |
End posion on genome | 885 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
atcggtccct |
tRNA gene sequence |
GGAGAGGTGCCGGAGCCAGGTCGATCGGGCCTCCCTGCTAAGGAGGTGTGGGGGCAACCT |
Downstream region at tRNA end position |
aatgtcatgc |
Secondary structure (Cloverleaf model) | >WENV180094296 Ser GCT t GCCg aatgtcatgc G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A C C G A G | | | | | G A G G C C G T G G G C G + | | | T T G T C G G T C G A G TGTGGGGGCAACCTCACC C - G C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |