Sequence ID | >WENV180094330 |
Genome ID | MTBK01002339 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 263 |
End posion on genome | 353 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cgcaggggtt |
tRNA gene sequence |
GGAGATGTACTCAAGAGGCTTAAGAGGTGCCCCTGCTAAGGGTATAGGTCGGGAAACTGG |
Downstream region at tRNA end position |
tttgaaaact |
Secondary structure (Cloverleaf model) | >WENV180094330 Ser GCT t GCCA tttgaaaact G - C G - C A - T G - C A - T T - A G - C T A T C A C C C A A G A A | | | | | A G A C T C G T G G G C G | | | T T C A G A G T T A G TAGGTCGGGAAACTGGCGC T - A G + T C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |