Sequence ID | >WENV180094380 |
Genome ID | MTBK01004099 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 327 |
End posion on genome | 241 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gagtctgttg |
tRNA gene sequence |
GGAGAGATGTCCGAGTGGTCGAAGGAGACGGATTCGAAATCCGTTGTACTGTTTACGGTA |
Downstream region at tRNA end position |
cagtccctct |
Secondary structure (Cloverleaf model) | >WENV180094380 Ser CGA g Gttg cagtccctct G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T T A G G A C G A G TGTACTGTTTACGGTACC A - T C - G G - C G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |