Sequence ID | >WENV180094383 |
Genome ID | MTBK01004170 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 646 |
End posion on genome | 561 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
nnnnnnatat |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGCATACACGTACGACTCAAAATCGTATGGGCTTCGCCCGTGT |
Downstream region at tRNA end position |
ttgcttttta |
Secondary structure (Cloverleaf model) | >WENV180094383 Leu CAA t ACCA ttgcttttta G - C C - G C - G G - C A - T A - T G - C T C T C A C C C A T A A G | | | | | G T G G T G G T G G G C G | | | T T G A C A C C A T G TGGGCTTCGCCCGT T - A A - T C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |