Sequence ID | >WENV180094388 |
Genome ID | MTBK01004390 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 6736 |
End posion on genome | 6825 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
atttccgtgt |
tRNA gene sequence |
GGAGGGGTCGCATAGCGGTCTAGTGCGGCGGTCTTGAAAACCGCTATTCCCGCGAGGGAA |
Downstream region at tRNA end position |
gtaagaatca |
Secondary structure (Cloverleaf model) | >WENV180094388 Ser TGA t GCCA gtaagaatca G - C G - C A - T G - C G - C G - C G - C T A T C T C T C A C G A C | | | | | G G T A C G G A G A G C G + | | | T T T G T G C C T A G TATTCCCGCGAGGGAATC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |