Sequence ID | >WENV180094391 |
Genome ID | MTBK01004404 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 209 |
End posion on genome | 294 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
atatttgtga |
tRNA gene sequence |
GCGGGGGTTTCCAAGCCAGGTCAAAGGAGCAGGGTTGAGGGCCCTGTCGCGCAGGCGTTC |
Downstream region at tRNA end position |
atttctcttt |
Secondary structure (Cloverleaf model) | >WENV180094391 Leu GAG a ACta atttctcttt G - C C - G G - C G - C G - C G - C G - C T A T T G C C C A C C G A T + | | | | G A A C C T G C G G G C G | | | T T G A G G A T C A A G TCGCGCAGGCGTTC C - G A - T G - C G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |