Sequence ID | >WENV180094400 |
Genome ID | MTBK01005062 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1373 |
End posion on genome | 1286 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ataacaatgt |
tRNA gene sequence |
GCTGAAGTGGTGAAATTGGTATACACGCTAGTTTCAGGGACTAGTGAGCAATGAGCTCAT |
Downstream region at tRNA end position |
tttttatttg |
Secondary structure (Cloverleaf model) | >WENV180094400 Leu CAG t ACCA tttttatttg G - C C - G T - A G - C A - T A - T G - C T G T C C C C C A T A A G | | | | | G T A G T G G G G G G C G | | | T T G A C A C T A T G TGAGCAATGAGCTCAT C - G T - A A - T G - C T - A T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |