Sequence ID | >WENV180094409 |
Genome ID | MTBK01005587 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 474 |
End posion on genome | 389 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tagaacaagt |
tRNA gene sequence |
GGAGGATTAGTCCTAACTGGTAAGGCAGCGGTCTTGAAAACCGCCGGGTTCTGCCCTTGG |
Downstream region at tRNA end position |
gttttataga |
Secondary structure (Cloverleaf model) | >WENV180094409 Ser TGA t GCCA gttttataga G - C G - C A - T G - C G - C A - T T - A T A T C T C C C A A A T A | + | | | G C C C T G G G G G G C T | + | T T G A G G C G T A A CGGGTTCTGCCCTT G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |