Sequence ID | >WENV180094415 |
Genome ID | MTBK01005753 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 310 |
End posion on genome | 396 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
acggcgaaaT |
tRNA gene sequence |
GGAGGGATGGCCGAGCGGACTAAGGCGCCTGTCTTGAAAACAGGTATGGGGAAACCCATC |
Downstream region at tRNA end position |
ggaacaaacc |
Secondary structure (Cloverleaf model) | >WENV180094415 Ser TGA T GTtc ggaacaaacc G - C G - C A - T G + T G - C G - C A - T T A T C A C C C A C G A G | | | | | G G G C C G G T G G G C G | | | T T A A G G C C T A G TATGGGGAAACCCATC C - G C - G T - A G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |