Sequence ID | >WENV180094416 |
Genome ID | MTBK01005753 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 416 |
End posion on genome | 505 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
accgacatct |
tRNA gene sequence |
GGGGAGGTGCCAGAGTGGACGAATGGGGCCGCCTGCTAAGTGGTTGTTGGAGTAAAATCC |
Downstream region at tRNA end position |
ttttaacgat |
Secondary structure (Cloverleaf model) | >WENV180094416 Ser GCT t GCtc ttttaacgat G - C G - C G - C G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G A C C G A G G G C G | | | T T A A T G G C G A G TGTTGGAGTAAAATCCAACC G + T C - G C - G G + T C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |