Sequence ID | >WENV180094417 |
Genome ID | MTBK01005835 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 131 |
End posion on genome | 45 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtggtgctca |
tRNA gene sequence |
GGAGGATTCGACTAGCGGCCTATGTCACACGCCTGGAACGCGTGCGGGTAGCAATACCCT |
Downstream region at tRNA end position |
atgactttca |
Secondary structure (Cloverleaf model) | >WENV180094417 Ser GGA a GCag atgactttca G - C G - C A - T G - C G - C A - T T T T A T C A C C C A C G A C | | | | | A G T C A G G T G G G C G | | | T T C T G T C C T A A CGGGTAGCAATACCCTC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |