Sequence ID | >WENV180094425 |
Genome ID | MTBK01006095 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 421 |
End posion on genome | 336 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
caattcttaa |
tRNA gene sequence |
GCCGGGGTGGCGGAACTGGCAGACGCACAGGACTTAAAATCCTGCGGTGAGTGATCACCG |
Downstream region at tRNA end position |
cattagttta |
Secondary structure (Cloverleaf model) | >WENV180094425 Leu TAA a Attt cattagttta G - C C - G C - G G - C G + T G - C G - C T T T C G G C C A C A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C C A G A CGGTGAGTGATCACCGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |