Sequence ID | >WENV180094436 |
Genome ID | MTBK01006374 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 410 |
End posion on genome | 324 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
caggtcgtaT |
tRNA gene sequence |
GCGGGGATAACCAAGCCAGGCCAACGGTGATAGACTCAAGATCTATTCTCGCAGGAGTTC |
Downstream region at tRNA end position |
tttattataa |
Secondary structure (Cloverleaf model) | >WENV180094436 Leu CAA T ATat tttattataa G - C C - G G - C G - C G - C G - C A - T T A T T T C C C A C C G A A | | | | | G A A C C A A A G G G C G | | | T T G C G G T C C A A G TCTCGCAGGAGTTC A - T T - A A - T G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |