Sequence ID | >WENV180094440 |
Genome ID | MTBK01006698 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 20012 |
End posion on genome | 20098 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ggggcccctt |
tRNA gene sequence |
GTCCGAGTGGCGGAATGGCAGACGCGCTAGCTTGAGGTGCTAGTGCCCTATTAACGGGCG |
Downstream region at tRNA end position |
ctttcgaatc |
Secondary structure (Cloverleaf model) | >WENV180094440 Leu GAG t ACtc ctttcgaatc G - C T - A C - G C - G G - C A - T G - C T G T C C C C C A T A A G | | | | | A G G G C G G G G G G C G | | | T T C A C G C A G G TGCCCTATTAACGGGCGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |