Sequence ID | >WENV180094459 |
Genome ID | MTBK01008214 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3796 |
End posion on genome | 3870 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tggatgcctg |
tRNA gene sequence |
GCCCCCGTAGCCCAACGGCAGAGGCAGGCGACTTAAAATCGCTCCAGGTGTCGGTTCGAA |
Downstream region at tRNA end position |
cgctcgaatc |
Secondary structure (Cloverleaf model) | >WENV180094459 Leu TAA g ACgg cgctcgaatc G + T C - G C - G C - G C - G C - G G - C T A T C A G C C A C A A A | | | | | G G C C C G G T C G G C G | | | T T C A G G C A G A CCAGGT G + T G - C C - G G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |