Sequence ID | >WENV180094468 |
Genome ID | MTBK01008441 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2931 |
End posion on genome | 3005 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tcaatcaaga |
tRNA gene sequence |
TGGGGTGTAGCCAAGCGGTAAGGCACGGGACTTTGACTCCCGCATTCGCAGGTTCAAATC |
Downstream region at tRNA end position |
aatgatccac |
Secondary structure (Cloverleaf model) | >WENV180094468 Gln TTG a GCCA aatgatccac T - A G - C G - C G - C G + T T - A G - C T A T C G T C C A G A A | | | | | A C A C C G G C A G G C G | | | T T G A G G C T A A CATTC C - G G - C G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |