Sequence ID | >WENV180094478 |
Genome ID | MTBK01009783 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1817 |
End posion on genome | 1730 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tcgccgcgtt |
tRNA gene sequence |
GCCCGGGTGGCGAAATGGCAGACGCAGAGGGCTTAAACCCCTTGGCCTCCAACGAGGCGT |
Downstream region at tRNA end position |
ggaatcgcag |
Secondary structure (Cloverleaf model) | >WENV180094478 Leu TAA t ACCA ggaatcgcag G - C C - G C - G C - G G - C G - C G - C T G T C G C C C A T A A G | | | | | G G A G C G G C G G G C G | | | T T C A C G C A G A GGCCTCCAACGAGGCGT G + T A - T G - C G - C G - C C C T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |