Sequence ID | >WENV180094484 |
Genome ID | MTBK01010347 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 511 |
End posion on genome | 413 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
taatcatagt |
tRNA gene sequence |
GGAAGCGGATCGGTCCTGGTGGGTCGCCTGGACTTCAAATCCAGTTTGCGCGGCGGTGAT |
Downstream region at tRNA end position |
aattcttaaa |
Secondary structure (Cloverleaf model) | >WENV180094484 SeC TCA t GCCA aattcttaaa G - C G - C A - T A - T G - C C - G G - C G A T T A C A C C C A T C C T | | | | | G G T G G C G T G G G C G + + | | T T T G T C G G G C TTTGCGCGGCGGTGATCCCGTCGCGG C - G T - A G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |