Sequence ID | >WENV180094518 |
Genome ID | MTBK01012086 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2247 |
End posion on genome | 2321 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
catataatat |
tRNA gene sequence |
TCCGCGATAGCTCAATGGTGGAGCACTCGGCTGTTAACCGATAGGCTGGAGGTTCGAGTC |
Downstream region at tRNA end position |
ttttaaatta |
Secondary structure (Cloverleaf model) | >WENV180094518 Asn GTT t GCCA ttttaaatta T - A C - G C - G G - C C - G G - C A - T T G T T C T C C A A A A + | | | | G T C T C G G G A G G C G | | | | T T G G A G C T G A AGGCT C T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |