Sequence ID | >WENV180094547 |
Genome ID | MTBK01014384 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 11400 |
End posion on genome | 11476 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
cacctgctat |
tRNA gene sequence |
TGCAGGGTAGAGAAGTGGACTATCTCATCAGTCTCATAAACTGAAAATCACTGGTTCGAA |
Downstream region at tRNA end position |
tagagcattg |
Secondary structure (Cloverleaf model) | >WENV180094547 fMet CAT t CCCA tagagcattg T T G - C C - G A - T G - C G - C G - C T A T T G A C C A T G A A | | | | | G G A G A G A C T G G C G | | | | T T A T C T C C T A A AAATC T - A C - G A - T G - C T - A C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |