Sequence ID | >WENV180094569 |
Genome ID | MTBK01015958 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 227 |
End posion on genome | 317 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
acaaaatctc |
tRNA gene sequence |
GGAAGGGTGGATGAGCGGTTTAAGTCGCACGCCTGGAAAGCGTGTTTAGGTGAATAACTT |
Downstream region at tRNA end position |
tcaactagtt |
Secondary structure (Cloverleaf model) | >WENV180094569 Ser GGA c GCCA tcaactagtt G - C G - C A - T A - T G - C G - C G - C T A T C G C C C A C G A G | | | | | G G G T A G G C G G G C G + | | T T T A G T C T T A G TTTAGGTGAATAACTTAAC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |