Sequence ID | >WENV180094600 |
Genome ID | MTBK01017038 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 698 |
End posion on genome | 608 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cgcccggcat |
tRNA gene sequence |
GGAGAAGTACCCAAGAGGTCGAAGGGGACGGTTTGCTAAACCGTTAGTGGGGGCAACTCC |
Downstream region at tRNA end position |
aaaaatccca |
Secondary structure (Cloverleaf model) | >WENV180094600 Ser GCT t GCCA aaaaatccca G - C G - C A - T G - C A - T A - T G - C T A T C T C C C A A G A A | | | | | A G A C C C G A G G G C G | | | T T T A G G G C G A G TAGTGGGGGCAACTCCAGC A - T C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |