Sequence ID | >WENV180094609 |
Genome ID | MTBK01017583 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 712 |
End posion on genome | 801 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ctgcggcgcc |
tRNA gene sequence |
GGACGGAAGGGTGGCCGAGTGGTTAAAGGCAGCAGACTGTAAATCTGCCCGCGCAAGCGT |
Downstream region at tRNA end position |
ccatccccta |
Secondary structure (Cloverleaf model) | >WENV180094609 Tyr GTA c ACCA ccatccccta G - C G - C A - T C - G G + T G - C A C T A A C G A T C A C G G | | | | | G C G T G G G C T A G C G + + + T T A G G T T G T A ATCTGCCCGCGCAAGCGTAC A A A A G + T G G C T A C G A C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |