Sequence ID | >WENV180094615 |
Genome ID | MTBK01018312 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1542 |
End posion on genome | 1453 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tgtactttaa |
tRNA gene sequence |
GCCGAGGTGGTGGAATTGGCAGACACGCTACCTTGAGGTGGTAGTGAGACTAATACTCTC |
Downstream region at tRNA end position |
aaagcattcc |
Secondary structure (Cloverleaf model) | >WENV180094615 Leu GAG a ACCA aaagcattcc G - C C - G C - G G - C A - T G - C G - C T C T T G T C C A T A A G + | | | | A T G G T G G C A G G C G | | | T T G A C A C C A G G TGAGACTAATACTCTCGT C - G T - A A - T C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |