Sequence ID | >WENV180094631 |
Genome ID | MTBK01019390 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1193 |
End posion on genome | 1107 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gggtacacca |
tRNA gene sequence |
GGAGAGATGCCTGAGCGGTCGAAAGGACACGCTTGGAGAGCGTGCGTATGAGAAATCGTA |
Downstream region at tRNA end position |
atactatact |
Secondary structure (Cloverleaf model) | >WENV180094631 Ser GGA a Gtac atactatact G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A C G A G | | | | | G G G T C C G T G G G C G | | | T T T A A G G C G A A CGTATGAGAAATCGTACC C - G A - T C - G G - C C - G T A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |