Sequence ID | >WENV180094641 |
Genome ID | MTBK01020834 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 4927 |
End posion on genome | 4843 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cccgcaaaat |
tRNA gene sequence |
GCCCAGGTGGTGGAATTGGTAGACACGCCACTTTGAGGGGGTGGTGCCGGTTACGGTGTG |
Downstream region at tRNA end position |
ttactaaaac |
Secondary structure (Cloverleaf model) | >WENV180094641 Leu GAG t ACgt ttactaaaac G - C C - G C - G C - G A - T G - C G - C C T T T G T T C A T A A G + | | | | G T G G T G G C A A G C G | | | T T G A C A C T A G G TGCCGGTTACGGTGT C - G C - G A - T C - G T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |