Sequence ID | >WENV180094646 |
Genome ID | MTBK01021375 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 100 |
End posion on genome | 15 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ctaatcttta |
tRNA gene sequence |
GGAGGGGTTCCCGAGTTGGCCAAAGGGGGCAGACTGTAAATCTGCTGGCAGTGCCTTCAC |
Downstream region at tRNA end position |
tacacggcgc |
Secondary structure (Cloverleaf model) | >WENV180094646 Tyr GTA a ACCA tacacggcgc G - C G - C A - T G - C G - C G - C G - C T A T T G T C C A T T G A T | | | | | A G G C C C A C A G G C G | | | T T C A G G G C A A G TGGCAGTGCCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |