Sequence ID | >WENV180094657 |
Genome ID | MTBK01022384 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 299 |
End posion on genome | 383 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ctttttgagt |
tRNA gene sequence |
GCGAGAGTGGCGGAATGGCAGACGCGCTAGACTTAGGATCTAGTGGGCAACCCCCGTGAG |
Downstream region at tRNA end position |
ctgttaaaca |
Secondary structure (Cloverleaf model) | >WENV180094657 Leu TAG t ACCA ctgttaaaca G - C C - G G - C A - T G - C A - T G - C T C T C T C C C A T A A G | | | | | G G G G C G G A G G G C G | | | T T C A C G C A G G TGGGCAACCCCCGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |