Sequence ID | >WENV180094659 |
Genome ID | MTBK01022498 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 829 |
End posion on genome | 915 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttgataatgc |
tRNA gene sequence |
GGAGGGATGTCCGAACGGCTAAGGGGCCGGACTTGAAATCCGGTGTAGGCGAAAGCTGTC |
Downstream region at tRNA end position |
tgtattcaag |
Secondary structure (Cloverleaf model) | >WENV180094659 Ser TGA c GCCA tgtattcaag G - C G - C A - T G - C G - C G - C A - T T A T G A C C C A C A A G | | | | | G G G C C T C T G G G C G | | + T T C A G G G T A G TGTAGGCGAAAGCTGT C - G C - G G - C G - C A - T C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |