Sequence ID | >WENV180094674 |
Genome ID | MTBK01024005 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 199 |
End posion on genome | 126 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
catggcgcac |
tRNA gene sequence |
GGCGCGATAGCAAAGCGGTTATGCACCGGATTGCAAATCCGTTGAGGCCGGTTCGACTCC |
Downstream region at tRNA end position |
gcgacgacac |
Secondary structure (Cloverleaf model) | >WENV180094674 Cys GCA c TCCA gcgacgacac G - C G - C C - G G - C C - G G - C A - T T C T C G G C C A G A A | | | | | G C A A C G G C C G G C G | | | T T G A T G C T T A TGAG C T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |