Sequence ID | >WENV180094675 |
Genome ID | MTBK01024048 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1010 |
End posion on genome | 925 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aagtcgaaaa |
tRNA gene sequence |
GCCGAAGTGGCTGAACGGTAGACGCGCTGCGTTCAGGGCGCAGTGGGCTAAAGCCCGTGT |
Downstream region at tRNA end position |
taaagaaatg |
Secondary structure (Cloverleaf model) | >WENV180094675 Leu CAG a ACCA taaagaaatg G - C C - G C - G G - C A - T A - T G - C T A T C A C C C A C A A G | | | | | A G G T C G G T G G G C G | | T T T A C G C A G G TGGGCTAAAGCCCGT C - G T - A G - C C - G G - C T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |