Sequence ID | >WENV180094688 |
Genome ID | MTBK01024420 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 616 |
End posion on genome | 533 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tgcggttttc |
tRNA gene sequence |
GGGCGAGTGGCGGAATGGCAGACGCAGCGGACTTAAACTCCGCTGGGGGCAACCCCATGA |
Downstream region at tRNA end position |
gggattttga |
Secondary structure (Cloverleaf model) | >WENV180094688 Leu TAA c ACac gggattttga G - C G - C G - C C - G G - C A - T G - C T A T C T C T C A T A A G | | | | | G G G G C G G A G A G C G | | | T T C A C G C A G A TGGGGGCAACCCCAT G - C C - G G - C G - C A - T C C T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |