Sequence ID | >WENV180094698 |
Genome ID | MTBK01025557 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 231 |
End posion on genome | 145 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
atgcctttat |
tRNA gene sequence |
GCCCGGGTGGCGGAATTGGTAGACGCACTAGTTTCAGGGACTAGCGAGGGCAACCTTGTG |
Downstream region at tRNA end position |
taagcggaga |
Secondary structure (Cloverleaf model) | >WENV180094698 Leu CAG t ACCA taagcggaga G - C C - G C - G C - G G - C G - C G - C C T T T G T T C A T A A G + | | | | G T G G C G G C A A G C G | | | T T G A C G C T A G A CGAGGGCAACCTTGT C - G T - A A - T G - C T - A T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |