Sequence ID | >WENV180094734 |
Genome ID | MTBK01027563 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 12674 |
End posion on genome | 12760 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cttaaaatgt |
tRNA gene sequence |
GGAAGGGTGGCCGAGTGGTTTAAGGCAAAGGTTTGCTAAACCTTGGCGCTTTCGGCGCCT |
Downstream region at tRNA end position |
tcttgttaaa |
Secondary structure (Cloverleaf model) | >WENV180094734 Ser GCT t GCtc tcttgttaaa G - C G - C A - T A - T G - C G - C G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T T A A GGCGCTTTCGGCGCCTC A - T A - T G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |