Sequence ID | >WENV180094736 |
Genome ID | MTBK01027585 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 13746 |
End posion on genome | 13835 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gttataaaag |
tRNA gene sequence |
GGAGAGGTGGCAGAGCGGTCGAATGCGGCGGTCTCGAAAACCGTTGTCCTACGTAAGAGG |
Downstream region at tRNA end position |
ttttttcaac |
Secondary structure (Cloverleaf model) | >WENV180094736 Ser CGA g GCaa ttttttcaac G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A C G A G | | | | | G G G A C G G G G G G C G | | | T T T A T G C C G A G TGTCCTACGTAAGAGGGACC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |