Sequence ID | >WENV180094741 |
Genome ID | MTBK01027950 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 165527 |
End posion on genome | 165611 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tgtccggtgt |
tRNA gene sequence |
GCCGAGGTGGCGAAATTGGCAGACGCACTAGACTTAGGATCTAGCGCCGCGAGGCGTGCA |
Downstream region at tRNA end position |
aaatttaatt |
Secondary structure (Cloverleaf model) | >WENV180094741 Leu TAG t ACCA aaatttaatt G - C C - G C - G G - C A - T G - C G - C T T T T G T C C A T A A G + | | | | G T A G C G G C A G G C G | | | T T G A C G C C A G A CGCCGCGAGGCGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |