Sequence ID | >WENV180094743 |
Genome ID | MTBK01027950 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 369881 |
End posion on genome | 369955 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
atcatttgcc |
tRNA gene sequence |
GCGGGAGTAGCTCAGTGGTAGAGCGCGACCTTGCCAAGGTCGAAGTCGCGAGTTCGACCC |
Downstream region at tRNA end position |
gtttccgaaa |
Secondary structure (Cloverleaf model) | >WENV180094743 Gly GCC c TCCA gtttccgaaa G - C C - G G - C G - C G - C A - T G - C C C T T G C T C A G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A G AAGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |