Sequence ID | >WENV180094745 |
Genome ID | MTBK01027950 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 469841 |
End posion on genome | 469757 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gatcttctaa |
tRNA gene sequence |
GCTCAGGTGGCGTAATTGGTAGCCGCGCACGTTTGAGGGGCGTGTGGAGAAATCCGTGCG |
Downstream region at tRNA end position |
tcttcccaag |
Secondary structure (Cloverleaf model) | >WENV180094745 Leu GAG a ACCA tcttcccaag G - C C - G T - A C - G A - T G - C G - C T G T C G C T C A T A A G | | | | | G T T G C G G C G A G C G | | | T T G C C G C T A G G TGGAGAAATCCGT C - G A - T C - G G - C T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |