Sequence ID | >WENV180094749 |
Genome ID | MTBK01028143 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 209 |
End posion on genome | 116 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tgagctttgc |
tRNA gene sequence |
GGAGAGGTGGCTGAGTTGGTTGAAGGCGCCCGCCTGGAGAGCGGGTAGGCAGAAGCTCTC |
Downstream region at tRNA end position |
tattttgtca |
Secondary structure (Cloverleaf model) | >WENV180094749 Ser GGA c GCCA tattttgtca G - C G - C A - T G - C A - T G - C G - C T A T C G C C C A T T G A G | | | | | G G G T C G G C G G G C G + | | T T T A G G C T G A G TAGGCAGAAGCTCTCTGTCTC C - G C - G C - G G - C C - G C A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |