Sequence ID | >WENV180094750 |
Genome ID | MTBK01028195 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 65315 |
End posion on genome | 65400 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ctgactggct |
tRNA gene sequence |
GCTCGAATGGTGGAATGGTAGACACGAGGGACTTAAAATCCCTTGGCCTTTATCGGCTGT |
Downstream region at tRNA end position |
tcatcccaaa |
Secondary structure (Cloverleaf model) | >WENV180094750 Leu TAA t ACtg tcatcccaaa G - C C - G T - A C - G G - C A - T A - T T G T T G C C C A T A A G | | | | | G G G G T G A C G G G C G | | | T T T A C A C A G G TGGCCTTTATCGGCTGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |